pDGB1alpha2_KanR_BastaR_Rb7_GFP
(Plasmid #186427)

• Purpose: optimisation of phosphinothricin (Basta) selection in plant cells; combines kanamycin resistance gene (nptII) and Basta resistance gene (bar) with fluorescent marker (eGFP)
• Depositing Lab: Lukas Fischer
• Publication: Kobercova et al Plant Cell Rep. 2023 Jan 7. doi: 10.1007/s00299-022-02975-7.

Backbone

• Vector backbone: pDGB1_alpha2 (Plasmid #68225)
• Backbone manufacturer: GoldenBraid 2.0 kit from Diego Orzaez (Addgene kit # 1000000076 ), IBMCP, Valencia, Spain
• Backbone size w/o insert (bp): 2610
• Total vector size (bp): 9412
• Vector type: Plant Expression, Synthetic Biology ; binary vector for Escherichia coli and Agrobacterium tumefaciens-mediated plant transformation

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: KanR
• Alt name: kanamycin resistance
• Alt name: neomycin phosphotransferase II with nopaline synthase promoter/terminator
• Alt name: nptII
• Species: A. thaliana (mustard weed), Synthetic
• Insert Size (bp): 1398
• Mutation: BsaI and BsmBI sites removed
• Promoter: Pnos

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsaI (destroyed during cloning)
• 3′ cloning site: BsaI (destroyed during cloning)
• 5′ sequencing primer: pDGB1_alpha_F: CAACCTCTCGGGCTTCTGGA
• 3′ sequencing primer: RB7-MAR-5: GGTTCGAATTTGTTTTACTC

Gene/Insert 2

• Gene/Insert name: BastaR
• Alt name: bar gene for plant expression
• Alt name: phosphinothricin (bialaphos) resistance
• Alt name: phosphinothricin N-acetyltransferase
• Species: A. thaliana (mustard weed), Synthetic
• Insert Size (bp): 2021
• Mutation: BsaI and BsmBI sites removed
• Promoter: CaMV 35S

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsaI (destroyed during cloning)
• 3′ cloning site: BsaI (destroyed during cloning)
• 5′ sequencing primer: pDGB1_alpha_F: CAACCTCTCGGGCTTCTGGA
• 3′ sequencing primer: RB7-MAR-5: GGTTCGAATTTGTTTTACTC

Gene/Insert 3

• Gene/Insert name: Rb7
• Alt name: matrix attachment region Rb7 from N. tabacum
• Alt name: derived from pUPD1:Rb7-MAR (Plasmid #106212)
• Species: A. thaliana (mustard weed), Synthetic
• Insert Size (bp): 1166
• Mutation: BsaI and BsmBI sites removed

Cloning Information for Gene/Insert 3

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsaI (destroyed during cloning)
• 3′ cloning site: BsaI (destroyed during cloning)
• 5′ sequencing primer: -
• 3′ sequencing primer: -

Gene/Insert 4

• Gene/Insert name: eGFP
• Alt name: green fluorescent protein
• Alt name: plant expression driven by the 35S promoter and enhanced by 5'UTR/3'UTR from Cowpea Mosaic Virus (CPMV) RNA-2
• Species: A. thaliana (mustard weed), Synthetic
• Insert Size (bp): 2217
• Mutation: BsaI and BsmBI sites removed
• Promoter: CaMV 35S

Cloning Information for Gene/Insert 4

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsaI (destroyed during cloning)
• 3′ cloning site: BsaI (destroyed during cloning)
• 5′ sequencing primer: RB7-MAR-3: AAAGAATGGCAGTTTTCCTT
• 3′ sequencing primer: pDGB1_alpha_R: GCGACTTAGTTTACCCGCCAA

Resource Information

• Supplemental Documents:
  • pDGB1alpha2_KanR_BastaR_Rb7_GFP.gb
• A portion of this plasmid was derived from a plasmid made by: We combined four transcriptional units together. Originally, transcriptional units BastaR, Rb7 and eGFP were prepared by Tomáš Moravec ( IEB, Prague, Czech Republic); KanR comes from pEGB Tnos:NptII:Pnos (#68212, Addgene).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry