pPB-CAG-Dnmt3a2-Ires2-mCherry-SV40
(Plasmid #186969)

• Purpose: PiggyBac vector encoding mouse Dnmt3a2 with Ires2-mCherry fluorescent marker for expression in mammalian cells.
• Depositing Lab: Brian Liau
• Publication: Lue et al Nat Chem Biol. 2023 Feb;19(2):176-186. doi: 10.1038/s41589-022-01167-4. Epub 2022 Oct 20.

Backbone

• Vector backbone: pPB
• Backbone manufacturer: System Biosciences
• Backbone size w/o insert (bp): 4846
• Total vector size (bp): 8782
• Vector type: Mammalian Expression ; PiggyBac
• Selectable markers: mCherry (fluorescence)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Dnmt3a2
• Species: M. musculus (mouse), Synthetic
• Insert Size (bp): 3975
• Mutation: Isoform 2 (residues 220–908)
• GenBank ID: NM_007872.4
• Entrez Gene: Dnmt3a (a.k.a. MmuIIIA)
• Promoter: CAG
• Tag / Fusion Protein:
  • Flag (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: CAG-SF TTATGGTAATCGTGCGAGAGG
• 3′ sequencing primer: SV40-SF GGTACCAGGTAAGTGTACCCAA

Resource Information

• Supplemental Documents:
  • pPB-CAG-Dnmt3a2-Ires2-mCherry-SV40.gb
• A portion of this plasmid was derived from a plasmid made by: Ires2-mCherry was derived from Cilantro2, a gift from B. Ebert (Addgene #74450). SV40 was derived from PhiC31-Neo-ins-5xTetO-pEF-H2B-Citrine-ins, a gift from M. Elowitz (Addgene #78099). The pPB vector backbone was prepared by restriction digest of pSLQ2817, a gift from S. Qi (Addgene #84239).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • piggyBac Limited Use Label License
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry