ATP1A1_T804N_hPGK1_EBFP_Donor
(Plasmid #187455)

• Purpose: HDR donor plasmid to introduce the T804N mutation conferring cellular resistance to ouabain and the EBFP cassette to ATP1A1 intron 17.
• Depositing Lab: Yannick Doyon
• Publication: Levesque et al Nat Commun. 2022 Oct 7;13(1):5909. doi: 10.1038/s41467-022-33669-z.

Backbone

• Vector backbone: pUC19
• Total vector size (bp): 5382
• Vector type: Mammalian Expression
• Selectable markers: Ouabain

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ATP1A1-T804N EBFP donor
• Species: H. sapiens (human)
• Insert Size (bp): 1584
• Entrez Gene: ATP1A1 (a.k.a. CMT2DD, HOMGSMR2)
• Promoter: hPGK1

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: NheI (not destroyed)
• 5′ sequencing primer: TGAGCGAGGAAGCGGAAGAG
• 3′ sequencing primer: CAGGGTTATTGTCTCATGAGCGG

Resource Information

• Supplemental Documents:
  • ATP1A1_T804N_hPGK1_EBFP_Donor.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid can be used in combination with pX330_ATP1A1_G7 or eSpCas9(1.1)_No_FLAG_ATP1A1_G7 to target EBFP to ATP1A1 intron 17. A user-specified transgene of interest can also be cloned using restriction cloning sites upstream (KpnI, AflII, NcoI) and downstream (SbfI) of the EBFP gene cassette.

Please visit https://doi.org/10.1101/2021.11.02.464583 for bioRxiv preprint.