pEA106
(Plasmid #187872)

• Purpose: Expresses mCherry under the virB promoter.
• Depositing Lab: Kan Wang
• Publication: Aliu et al Plant Biotechnol J. 2022 Jun 11. doi: 10.1111/pbi.13872.

Backbone

• Vector backbone: pTF505
• Backbone manufacturer: Keunsub Lee
• Backbone size w/o insert (bp): 6149
• Total vector size (bp): 7214
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Spectinomycin and Streptomycin, 50 & 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mCherry
• Alt name: monomeric derivative of DsRed fluorescent protein
• Insert Size (bp): 711
• GenBank ID: AY678264.1 AAV52164.1
• Promoter: Agrobacterium virB promoter

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: MluI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: cgaattgtattgattggtgagct
• 3′ sequencing primer: ctatagcagcggaggggttg

Resource Information

• Supplemental Documents:
  • pEA106.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry