pSLPB2B-FKBP12_F36V-SpdCas9-tagRFPt-P2A-tagBFP-PGK-Blasticidin
(Plasmid #187951)

• Purpose: FKBP12 (F36V mutant) degron-tagged dCas9 fused with tagRFPt, P2A site and tagBFP, expressed under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance under PGK promoter.
• Depositing Lab: Edda Schulz
• Publication: Noviello et al Nat Commun. 2023 Jun 3;14(1):3225. doi: 10.1038/s41467-023-38909-4.

Backbone

• Vector backbone: pSLPB2-SpdCas9-tagRFPt-P2A-tagBFP-PGK-Blasticidin
• Backbone size w/o insert (bp): 11406
• Total vector size (bp): 11776
• Vector type: Mammalian Expression, CRISPR, Synthetic Biology
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: FKBP12_F36V-SpdCas9-tagRFPt-P2A-tagBFP
• Alt name: S. pyogenes Cas9 (D10A; N863A)
• Alt name: FKBP12 (F36V mutant)
• Species: H. sapiens (human), Synthetic; S. pyogenes
• Insert Size (bp): 2357
• Tag / Fusion Protein:
  • GGS linker (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: AGCGGCCGCGGAGTTCAGGT
• 3′ sequencing primer: GGATCCTTCCAGTTTTAGAA

Resource Information

• Supplemental Documents:
  • pSLP2B-NLS-dTAG-linker-dCas9-tagRFPt-P2A-tagBFP-pGK-Blasticidin Bv2.gb
• A portion of this plasmid was derived from a plasmid made by: The FKBP12F36V domain was amplified from pCRIS-PITChv2-Puro-dTAG (BRD4) was a gift from James Bradner & Behnam Nabet (Addgene plasmid # 91793 ; http://n2t.net/addgene:91793 ; RRID:Addgene_91793)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
  • piggyBac Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/2022.10.05.511019v1 for bioRxiv preprint.