BiFC4
(Plasmid
#190049)
-
PurposeBiFC plasmid for C-terminal tagging of genes with yEmVenus (aa 173–238)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 190049 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepC2YP
-
Vector typeYeast Expression
-
Selectable markerscdARG4
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameYemVenus (ATG-aa173-238)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CCGGCTAGCGATGGTGGTGTTCAATTAGCTGAC
- 3′ sequencing primer CCGACGCGTTTATTTGTACAATTCATCCATACCATGGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
BiFC4 was a gift from Patrick Van Dijck (Addgene plasmid # 190049 ; http://n2t.net/addgene:190049 ; RRID:Addgene_190049) -
For your References section:
A Bimolecular Fluorescence Complementation Tool for Identification of Protein-Protein Interactions in Candida albicans. Subotic A, Swinnen E, Demuyser L, De Keersmaecker H, Mizuno H, Tournu H, Van Dijck P. G3 (Bethesda). 2017 Oct 5;7(10):3509-3520. doi: 10.1534/g3.117.300149. 10.1534/g3.117.300149 PubMed 28860184
