Skip to main content

EB3N-VVDfast-Halo-iLID
(Plasmid #190166)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 190166 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 190166-D50 50 μg of DNA in Tris buffer $495
DNA 190166-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pB80
  • Backbone manufacturer
    Lukas Kapitein lab
  • Backbone size w/o insert (bp) 6000
  • Total vector size (bp) 8487
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    EB3N-VVDfast-Halo-iLID
  • Alt name
    EB3N (1-189)-VVDfast-Halo-iLID
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
    2331
  • Mutation
    1-189 aa from EB3
  • GenBank ID
    AB025186.1
  • Entrez Gene
    MAPRE3 (a.k.a. EB3, EBF3, EBF3-S, RP3)
  • Tag / Fusion Protein
    • -VVDfast-mClover3-iLID (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ggcttctggcgtgtgaccggcgg
  • 3′ sequencing primer cctcccacacctccccctgaacct
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    EB3N-VVDfast-Halo-iLID was a gift from Anna Akhmanova (Addgene plasmid # 190166 ; http://n2t.net/addgene:190166 ; RRID:Addgene_190166)
  • For your References section:

    Opto-katanin, an optogenetic tool for localized, microtubule disassembly. Meiring JCM, Grigoriev I, Nijenhuis W, Kapitein LC, Akhmanova A. Curr Biol. 2022 Nov 7;32(21):4660-4674.e6. doi: 10.1016/j.cub.2022.09.010. Epub 2022 Sep 28. 10.1016/j.cub.2022.09.010 PubMed 36174574