EB3N-VVDfast-Halo-iLID
(Plasmid #190166)

• Purpose: Expresses EB3N-VVDfast-Halo-iLID, a microtubule anchor used for optogenetic recruitment of SspB-mCh-p60, in mammalian cells.
• Depositing Lab: Anna Akhmanova
• Depositing Organization: Utrecht University
  Located in Netherlands
• Publication: Meiring et al Curr Biol. 2022 Nov 7;32(21):4660-4674.e6. doi: 10.1016/j.cub.2022.09.010. Epub 2022 Sep 28.

Backbone

• Vector backbone: pB80
• Backbone manufacturer: Lukas Kapitein lab
• Backbone size w/o insert (bp): 6000
• Total vector size (bp): 8487
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: EB3N-VVDfast-Halo-iLID
• Alt name: EB3N (1-189)-VVDfast-Halo-iLID
• Species: H. sapiens (human), Synthetic
• Insert Size (bp): 2331
• Mutation: 1-189 aa from EB3
• GenBank ID: AB025186.1
• Entrez Gene: MAPRE3 (a.k.a. EB3, EBF3, EBF3-S, RP3)
• Tag / Fusion Protein:
  • -VVDfast-mClover3-iLID (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ggcttctggcgtgtgaccggcgg
• 3′ sequencing primer: cctcccacacctccccctgaacct

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • HaloTag Vector Limited Use Label License
• Industry Terms:
  • Not Available to Industry

DNA (Catalog # 190166-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • HaloTag Vector Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 190166-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • HaloTag Vector Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.