pcDNA3.1-SARS2-Spike-HiBiT
(Plasmid
#191212)
-
PurposeTransient expression in mammalian cells of SARS-CoV-2 (A1) spike protein tagged on the C-terminus with HiBiT, the high affinity small fragment of split nanoluciferase assay
-
Depositing Lab
-
Depositing OrganizationUniversity of Regina
Located in Canada -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 191212 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 191212-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 191212-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepcDNA3.1
-
Backbone manufacturerThermo Fisher
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSARS-CoV-2 spike_WT
-
Alt nameS
-
SpeciesSARS CoV-2
-
Insert Size (bp)477
-
Entrez GeneS (a.k.a. GU280_gp02, spike glycoprotein)
- Promoter CMV
-
Tag
/ Fusion Protein
- HiBiT (high affinity small nanoluciferase fragment) (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gcaggatgtggtgaatcaga
- 3′ sequencing primer BGH Reverse
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 191212-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 191212-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1-SARS2-Spike-HiBiT was a gift from Mohan Babu (Addgene plasmid # 191212 ; http://n2t.net/addgene:191212 ; RRID:Addgene_191212) -
For your References section:
Human protein interaction networks of ancestral and variant SARS-CoV-2 in organ-specific cells and bodily fluids. Broderick K, Moutaoufik MT, Saccon T, Malty R, Amin S, Phanse S, Joseph TP, Zilocchi M, Hosseinnia A, Istace Z, Hajikarimlou M, Abrar S, Fisher J, Brassard R, Perera R, Kumar A, Aoki H, Rahmatbakhsh M, Jessulat M, Kobasa D, Dehne F, Prasad B, Gagarinova A, Joanne Lemieux M, Cochrane A, Houry WA, Aly KA, Golshani A, Babu M. Nat Commun. 2025 Jul 1;16(1):5784. doi: 10.1038/s41467-025-60949-1. 10.1038/s41467-025-60949-1 PubMed 40593736