Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pcDNA3-ADAM17-HA
(Plasmid #65105)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 65105 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pcDNA3
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5446
  • Total vector size (bp) 7920
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ADAM17
  • Alt name
    TACE
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2474
  • GenBank ID
    NM_003183
  • Entrez Gene
    ADAM17 (a.k.a. ADAM18, CD156B, CSVP, NISBD, NISBD1, TACE)
  • Promoter CMV
  • Tag / Fusion Protein
    • HA (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer CACTGCTTACTGGCTTATCG
  • 3′ sequencing primer TGGCAACTAGAAGGCACAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Insert was PCR amplified from human placenta cDNA.
Insert contains several point mutations compared to NM_003183 (see sequence)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3-ADAM17-HA was a gift from Axel Ullrich (Addgene plasmid # 65105 ; http://n2t.net/addgene:65105 ; RRID:Addgene_65105)
  • For your References section:

    TACE cleavage of proamphiregulin regulates GPCR-induced proliferation and motility of cancer cells. Gschwind A, Hart S, Fischer OM, Ullrich A. EMBO J. 2003 May 15;22(10):2411-21. 10.1093/emboj/cdg231 PubMed 12743035