pDEST_5xUAS:EB3-mScarlet-I
(Plasmid
#192358)
-
PurposeEB3 tagged with mScarlet-I, expressed under the UAS promoter
-
Depositing Lab
-
Depositing OrganizationUniversity of Zurich
Located in Switzerland -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 192358 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 192358-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 192358-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneGateway Tol2 destination vector with zebrafish aA-crystallin promoter driving CFP in lens
- Total vector size (bp) 8129
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEB3
-
Alt nameMAPRE3
-
SpeciesH. sapiens (human)
-
Insert Size (bp)843
-
GenBank ID22924
-
Entrez GeneMAPRE3 (a.k.a. EB3, EBF3, EBF3-S, RP3)
-
Tag
/ Fusion Protein
- mScarlet-I (C terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer gtctgaaacacaggccagat
- 3′ sequencing primer CCACATTTGTAGAGGTTTTACTTGC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe EB3 cDNA was given by the Gilmour lab (Revenu et al. 2014), but was originally cloned by Stepanova et al. 2003.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit for https://www.biorxiv.org/content/10.1101/2022.08.12.503784v1 bioRxiv preprint.
DNA (Catalog # 192358-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 192358-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDEST_5xUAS:EB3-mScarlet-I was a gift from Francesca Peri (Addgene plasmid # 192358 ; http://n2t.net/addgene:192358 ; RRID:Addgene_192358) -
For your References section:
A role for the centrosome in regulating the rate of neuronal efferocytosis by microglia in vivo. Moller K, Brambach M, Villani A, Gallo E, Gilmour D, Peri F. Elife. 2022 Nov 18;11:e82094. doi: 10.7554/eLife.82094. 10.7554/eLife.82094 PubMed 36398880