pCK341
(Plasmid #192640)

• Purpose: Expresses dSpRY and MCP-SoxS(R93A/S101A) on p15A-CmR
• Depositing Lab: Jesse Zalatan
• Publication: Kiattisewee et al ACS Synth Biol. 2022 Nov 15. doi: 10.1021/acssynbio.2c00405.

Backbone

• Vector backbone: pCD442 (Addgene #153024)
• Backbone manufacturer: Jesse Zalatan
• Backbone size w/o insert (bp): 1726
• Total vector size (bp): 7368
• Vector type: CRISPR, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: Sp.pCas9-dSpRY
• Species: S. pyogenes (dCas9)
• Insert Size (bp): 4650
• Mutation: dSpRY has several mutations compared to dCas9
• Promoter: Sp.pCas9

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GCAACTGACTGAAATGCCTC
• 3′ sequencing primer: GCCTGGagatccttactcga

Gene/Insert 2

• Gene/Insert name: BBa_J23107-MCP-SoxS(R93A, S101A)
• Species: MS2 (MCP), E. coli (SoxS)
• Insert Size (bp): 802
• Mutation: SoxS has R93A and S101A mutations
• Promoter: BBa_J23107

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: tcagggtggtgaatctgcag
• 3′ sequencing primer: tcgtaagccatttccgctcg

Resource Information

• Supplemental Documents:
  • pCK341_dSpRY.gb
• A portion of this plasmid was derived from a plasmid made by: adapted from Benjamin Kleinstiver lab

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry