pCR-U6-gRNA-TRE3G-TdTomato
(Plasmid
#192658)
-
PurposeA plasmid encoding TRE3G sgRNA and TRE3G-promoter-TdTomato
-
Depositing Lab
-
Depositing OrganizationWashington University in Saint Louis
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 192658 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 192658-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 192658-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCR-Blunt II
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTdTomato
-
gRNA/shRNA sequenceTRE3G sgRNA: TACGTTCTCTATCACTGATA
-
SpeciesSynthetic
- Promoter U6, TRE3G
Cloning Information
- Cloning method TOPO Cloning
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 192658-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 192658-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCR-U6-gRNA-TRE3G-TdTomato was a gift from Jeffrey Miner (Addgene plasmid # 192658 ; http://n2t.net/addgene:192658 ; RRID:Addgene_192658) -
For your References section:
Comparative analysis of dCas9-VP64 variants and multiplexed guide RNAs mediating CRISPR activation. Omachi K, Miner JH. PLoS One. 2022 Jun 28;17(6):e0270008. doi: 10.1371/journal.pone.0270008. eCollection 2022. 10.1371/journal.pone.0270008 PubMed 35763517