pLenti-HIFR
(Plasmid #192946)

• Purpose: Lentiviral production of HIF-1alpha reporter
• Depositing Lab: Markus Covert
• Publication: Jeknic et al J Biol Chem. 2023 Mar 10:104599. doi: 10.1016/j.jbc.2023.104599.

Backbone

• Vector backbone: pLenti
• Backbone size w/o insert (bp): 6968
• Total vector size (bp): 12408
• Vector type: Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: HIF-1alpha reporter
• Alt name: HIFR
• Alt name: mCMV_UTR_HIF_mNeonGreen_HIF_P2A_mCerulean_PEST
• Species: M. musculus (mouse)
• Insert Size (bp): 5401
• Promoter: mCMV

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GACAGCAGAGATCCAGTTTG
• 3′ sequencing primer: GATATCCAGCACAGTGG

Resource Information

• Supplemental Documents:
  • psj304-plenti-mcmv_utr_trhif1al795a-middle-mneongreen_nogblock7_2a_h2b-mcerulean-pest.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • mNeonGreen Label License
• Industry Terms:
  • Not Available to Industry