Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

5HRE/GFP
(Plasmid #46926)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 46926 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pEF/myc/cyto
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5500
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    5X HRE of VEGF
  • Alt name
    VEGFA
  • Alt name
    VEGF
  • Species
    H. sapiens (human)
  • Mutation
    five copies of a 35-bp fragment from the hypoxia-responsive element (HRE) of the human VEGF gene and a human cytomegalovirus minimal promoter
  • Entrez Gene
    VEGFA (a.k.a. MVCD1, VEGF, VPF)
  • Promoter EF-1α promoter
  • Tag / Fusion Protein
    • d2EGFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer EF1a-F
  • 3′ sequencing primer BGHrev
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
  • Articles Citing this Plasmid

Depositor Comments

The 35-bp human VEGF HRE sequence is: CCACAGTGCATACGTGGGCTCCAACAGGTCCTCTT

The d2EGFP fragment was amplified from a Clontech (Palo Alto, CA) vector and encodes a destabilized red- shifted variant of wild-type GFP with an excitation maximum of 488 nm, an emission maximum of 507 nm, and a half-life of approximately 2 hours.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    5HRE/GFP was a gift from Martin Brown & Thomas Foster (Addgene plasmid # 46926 ; http://n2t.net/addgene:46926 ; RRID:Addgene_46926)
  • For your References section:

    Green fluorescent protein is a suitable reporter of tumor hypoxia despite an oxygen requirement for chromophore formation. Vordermark D, Shibata T, Brown JM. Neoplasia. 2001 Nov-Dec;3(6):527-34. 10.1038/sj/neo/7900192 PubMed 11774035