Skip to main content

LYSO-LRRK2
(Plasmid #193582)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 193582 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 193582-D50 50 μg of DNA in Tris buffer $495
DNA 193582-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pDEST
  • Backbone size w/o insert (bp) 5060
  • Total vector size (bp) 12512
  • Modifications to backbone
    LAMTOR1(1-39aa) and 3xFLAG sequences
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Leucine-rich repeat kinase 2
  • Alt name
    LRRK2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    7584
  • Entrez Gene
    LRRK2 (a.k.a. AURA17, DARDARIN, PARK8, RIPK7, ROCO2)
  • Promoter CMV
  • Tag / Fusion Protein
    • LAMTOR1(1-39aa) and 3xFLAG (N terminal on backbone)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer ATGGCTAGTGGCAGCTGTCAGGGGTGCGAAGAGGACGAGGAAACTCTGAAG
  • 3′ sequencing primer AAAAATGAGACGAACATCTGTTGAGTAA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LYSO-LRRK2 was a gift from Mark Cookson (Addgene plasmid # 193582 ; http://n2t.net/addgene:193582 ; RRID:Addgene_193582)
  • For your References section:

    Lysosomal positioning regulates Rab10 phosphorylation at LRRK2(+) lysosomes. Kluss JH, Beilina A, Williamson CD, Lewis PA, Cookson MR, Bonet-Ponce L. Proc Natl Acad Sci U S A. 2022 Oct 25;119(43):e2205492119. doi: 10.1073/pnas.2205492119. Epub 2022 Oct 18. 10.1073/pnas.2205492119 PubMed 36256825

Ready-to-use antibodies

Looking for antibodies related to this plasmid? Check out this option:

Learn More