pLV hU6-gRNA hUbC-VP64-dSaCas9-VP64-T2A-Thy1.1
(Plasmid #194279)

• Purpose: Expresses gRNA and VP64-dSaCas9-VP64 from lentiviral vector
• Depositing Lab: Charles Gersbach
• Publication: McCutcheon et al bioRxiv. 2023 May 1:2023.05.01.538906. doi: 10.1101/2023.05.01.538906. Preprint.

Backbone

• Vector backbone: FUGW
• Backbone size w/o insert (bp): 9579
• Total vector size (bp): 13812
• Vector type: Mammalian Expression, Lentiviral, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: humanized VP64 dSaCas9 VP64 T2A Thy1.1
• Insert Size (bp): 4233
• Promoter: hUbC
• Tag / Fusion Protein:
  • HA

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: gaaatgtaatcatttgggtc
• 3′ sequencing primer: ATGAAAGCCATACGGGAAGC

Gene/Insert 2

• Gene/Insert name: gRNA
• Promoter: hU6

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: Esp3I (destroyed during cloning)
• 3′ cloning site: Esp3I (destroyed during cloning)
• 5′ sequencing primer: GACTATCATATGCTTACCGT

Resource Information

• Supplemental Documents:
  • pSM54-AIO-hUBC-dSaCas9-2xVP64-2A-Thy1.1.gb
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://doi.org/10.1101/2023.05.01.538906 for bioRxiv preprint.