-
PurposeRetro and Lentiviral transduction of primary human germinal center B cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 163612 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonephCMV-ECO-ENV
-
Backbone manufacturerAddgene 15802
- Backbone size w/o insert (bp) 4764
- Total vector size (bp) 6825
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGaLV MTR envelope
-
Insert Size (bp)2061
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CTGGTCATCATCCTGCCTTT
- 3′ sequencing primer TTTTGGCAGAGGGAAAAAGA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid was generated by modification of Addgene plasmid 15802 to excise ENV-Eco and replace with ENV GALV-MTR.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
phCMV-GALV-MTR was a gift from Daniel Hodson (Addgene plasmid # 163612 ; http://n2t.net/addgene:163612 ; RRID:Addgene_163612) -
For your References section:
Genetic modification of primary human B cells to model high-grade lymphoma. Caeser R, Di Re M, Krupka JA, Gao J, Lara-Chica M, Dias JML, Cooke SL, Fenner R, Usheva Z, Runge HFP, Beer PA, Eldaly H, Pak HK, Park CS, Vassiliou GS, Huntly BJP, Mupo A, Bashford-Rogers RJM, Hodson DJ. Nat Commun. 2019 Oct 4;10(1):4543. doi: 10.1038/s41467-019-12494-x. 10.1038/s41467-019-12494-x PubMed 31586074