-
PurposeExpresses the envelope protein of Gibbon Ape Leukemia Virus (GALV) for pseudotyping of retroviral or lentiviral vectors
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 172217 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonephCMV
- Backbone size w/o insert (bp) 4816
- Total vector size (bp) 6892
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsAny strain, nothing special needed.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEnvelope protein of Gibbon Ape Leukemia Virus (codon-optimized version)
-
Alt namecoGALVenv
-
Alt nameCodon optimized for optimal expression in human packaging cells
-
SpeciesGibbon Ape Leukemia Virus
-
Insert Size (bp)2076
-
MutationCarries C-terminus of amphotropic MLV strain 4070A to increase packaging efficiency
- Promoter CMV immediate early promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer TCCTACAGCTCCTGGGCAAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that significantly lower amounts of this codon optimized plasmid are required for efficient packaging. Depending on the vector type and protocol used so far, optimal titers are achieved with 8 to 30 times less plasmid compared to non-codon optimized GALV env. We suggest to start with 0.02 µg per 1x10^6 293T packaging cells (resulting in about 0.1 µg phCMV-coGALVenv-C4070A plasmid per 10 cm cell culture dish). Full details are given in the publication.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
phCMV-coGALVenv-C4070A was a gift from Boris Fehse (Addgene plasmid # 172217 ; http://n2t.net/addgene:172217 ; RRID:Addgene_172217) -
For your References section:
Efficient Pseudotyping of Different Retroviral Vectors Using a Novel, Codon-Optimized Gene for Chimeric GALV Envelope. Mirow M, Schwarze LI, Fehse B, Riecken K. Viruses. 2021 Jul 27;13(8). pii: v13081471. doi: 10.3390/v13081471. 10.3390/v13081471 PubMed 34452336