lenti GFAABC1D-dCas9-KRAB-MeCP2
(Plasmid
#194701)
-
PurposeExpresses dCas9-KRAB-MeCP2 in Astrocytes
-
Depositing Lab
-
Depositing OrganizationVirginia Polytechnic Institute and State University
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 194701 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonelenti SYN-dCas9-KRAB-MeCP2
-
Backbone manufacturerJeremy Day Addgene plasmid #155365
- Backbone size w/o insert (bp) 13000
- Total vector size (bp) 13691
-
Modifications to backboneRemoved hSYN promoter
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGFAABC1D promoter
-
SpeciesH. sapiens (human)
-
Insert Size (bp)692
-
MutationNone
- Promoter GFAABC1D
-
Tag
/ Fusion Protein
- 3xFLAG (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PacI (not destroyed)
- 3′ cloning site AgeI (not destroyed)
- 5′ sequencing primer gcgccaattctgcagacaaa (5` --> 3`)
- 3′ sequencing primer tacttcttgtcggctgctgg (5` --> 3`)
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bypTYF-1xGfaABC1D-tTA was a gift from Sergey Kasparov (Addgene plasmid # 19977 ; http://n2t.net/addgene:19977 ; RRID:Addgene_19977)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
lenti GFAABC1D-dCas9-KRAB-MeCP2 was a gift from Timothy Jarome (Addgene plasmid # 194701 ; http://n2t.net/addgene:194701 ; RRID:Addgene_194701) -
For your References section:
Neuronal and astrocytic protein degradation are critical for fear memory formation. Farrell K, McFadden T, Jarome TJ. Learn Mem. 2023 Mar 15;30(3):70-73. doi: 10.1101/lm.053716.122. Print 2023 Mar. 10.1101/lm.053716.122 PubMed 36921984