CAGGS-AsCpf1(D908A)-2A-GFP-U6-AAVS1-sgRNA
(Plasmid
#194727)
-
PurposeCAGGS-AsCpf1(D908A)-2A-GFP-U6-sgRNA-cloning vector, with guide RNA array targeting hAAVS1.
-
Depositing Lab
-
Depositing OrganizationWhitehead Institute for Biomedical Research
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 194727 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 194727-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 194727-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCDNA3.12
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAsCpf1(D908A)
-
gRNA/shRNA sequenceatctgtcccctccaccccacagt
-
SpeciesAcidaminococcus sp.
-
Entrez GeneAAVS1 (a.k.a. AAV)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer unknown
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
p-69-AAVS1 of Supplemental Table 2 of https://www.biorxiv.org/content/10.1101/2022.04.13.488123v1.full
DNA (Catalog # 194727-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 194727-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CAGGS-AsCpf1(D908A)-2A-GFP-U6-AAVS1-sgRNA was a gift from Rudolf Jaenisch (Addgene plasmid # 194727 ; http://n2t.net/addgene:194727 ; RRID:Addgene_194727) -
For your References section:
Multiplex Genome Editing of Human Pluripotent Stem Cells Using Cpf1. Ma H. Bio Protoc. 2024 Nov 20;14(22):e5108. doi: 10.21769/BioProtoc.5108. eCollection 2024 Nov 20. 10.21769/BioProtoc.5108 PubMed 39600977