mCherry-APPP1-mGFP
(Plasmid #196705)

• Purpose: As mCherry-APP-mGFP, but with substitution at position 612 that prevents alpha-secretase activity
• Depositing Lab: Martino Calamai
• Publication: Capitini et al iScience. 2023 Apr 11;26(5):106611. doi: 10.1016/j.isci.2023.106611. eCollection 2023 May 19.

Backbone

• Vector backbone: pCMV6-AN-mGFP
• Backbone manufacturer: Origene
• Backbone size w/o insert (bp): 5900
• Total vector size (bp): 9400
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Amyloid Precursor Protein 695 isoform
• Alt name: amyloid beta precursor protein, APP, APP695
• Species: H. sapiens (human)
• Insert Size (bp): 3499
• Mutation: Lys to Val substitution at position 612
• Entrez Gene: APP (a.k.a. AAA, ABETA, ABPP, AD1, APPI, CTFgamma, CVAP, PN-II, PN2, alpha-sAPP, preA4)
• Tags / Fusion Proteins:
  • mCherry (N terminal on insert)
  • mEGFP (C terminal on backbone)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: GGACTTTCCAAAATGTCG
• 3′ sequencing primer: CCCACCAGCCTTGTCCTAAT

Resource Information

• Supplemental Documents:
  • mCherry-APP695-mEGFP P1 mut.str

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry