pET28a_DmKHC[1-421]-1xGFP-6xHis
(Plasmid
#196972)
-
PurposeBacterial expression plasmid for His tag-based purification of Drosophila melanogaster kinesin heavy chain [1-421] with C-terminal GFP tag and C-terminal 6xHis tag
-
Depositing Lab
-
Depositing OrganizationUtrecht University
Located in Netherlands -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 196972 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepET28a
- Backbone size w/o insert (bp) 5212
- Total vector size (bp) 7225
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsPurification from BL21. Induce protein expression with IPTG. After induction, grow at 18 degrees C.
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameKinesin Heavy Chain
-
Alt nameKHC, Khc, kinesin-1
-
SpeciesD. melanogaster (fly)
-
Insert Size (bp)2013
-
Entrez GeneKhc (a.k.a. Dmel_CG7765, 2R6, CG7765, DK, DKH, Dm KHC, DmK, DmKHC, Dmel\CG7765, Dmkin, KHC, KIF 5A, KIF5, KIF5B, KIN, Kif5, Kin, Kin-1, Kinesin, Kinesin-1, khc, kin, kinesin, kinesin-1, l(2)W12, l(2)k13219, l(2)k13314, l(2R)W12, pgs)
- Promoter T7 promoter
-
Tags
/ Fusion Proteins
- 6xHis (C terminal on insert)
- GFP (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer AATAATCCATGGGCATGAGCGCAGAACGAGAAATTCCAGC
- 3′ sequencing primer GGGTTATGCTAGTTATTGCTCAG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET28a_DmKHC[1-421]-1xGFP-6xHis was a gift from Lukas Kapitein (Addgene plasmid # 196972 ; http://n2t.net/addgene:196972 ; RRID:Addgene_196972) -
For your References section:
Differentiation between Oppositely Oriented Microtubules Controls Polarized Neuronal Transport. Tas RP, Chazeau A, Cloin BMC, Lambers MLA, Hoogenraad CC, Kapitein LC. Neuron. 2017 Dec 20;96(6):1264-1271.e5. doi: 10.1016/j.neuron.2017.11.018. Epub 2017 Nov 30. 10.1016/j.neuron.2017.11.018 PubMed 29198755