Skip to main content
Addgene
Open Menu

CB6-GFP-TAOK1
(Plasmid #197108)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 197108 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 197108-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 197108-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    N-GFP-CB6
  • Backbone manufacturer
    Michael Way
  • Backbone size w/o insert (bp) 7000
  • Total vector size (bp) 10705
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TAOK1
  • Alt name
    PSK2
  • Alt name
    KIAA1361
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3705
  • Mutation
    Wild Type
  • GenBank ID
    57551
  • Entrez Gene
    TAOK1 (a.k.a. DDIB, KFC-B, MAP3K16, MARKK, PSK-2, PSK2, TAO1, hKFC-B, hTAOK1)
  • Promoter CMV
  • Tag / Fusion Protein
    • GFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoR1 (not destroyed)
  • 3′ cloning site BamH1 (not destroyed)
  • 5′ sequencing primer TCACATGGTCCTGCTGGAGTT (GFP forward primer)
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Cloned by Jonathan Morris at KCL (subject to MTA with Addgene).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CB6-GFP-TAOK1 was a gift from Jonathan Morris (Addgene plasmid # 197108 ; http://n2t.net/addgene:197108 ; RRID:Addgene_197108)

  • For your References section:

    Rnd3 interacts with TAO kinases and contributes to mitotic cell rounding and spindle positioning. Garg R, Koo CY, Infante E, Giacomini C, Ridley AJ, Morris JDH. J Cell Sci. 2020 Mar 16;133(6):jcs235895. doi: 10.1242/jcs.235895. 10.1242/jcs.235895 PubMed 32041905
Related items:
Commonly requested with: