pAcBac1-Ma-Acridone-RS1 (A7)
(Plasmid #197566)

• Purpose: Expression of Methanomethylophilus alvus (Ma) Acridone RS1 (A7) tRNA synthetase/Pyl-tRNA pair for the encoding of Acridone at TAG codons in HEK293 cells
• Depositing Lab: Ryan Mehl
• Publication: Avila-Crump et al ACS Chem Biol. 2022 Dec 16;17(12):3458-3469. doi: 10.1021/acschembio.2c00639. Epub 2022 Nov 16.

Backbone

• Vector backbone: pAcBac1
• Backbone size w/o insert (bp): 9000
• Total vector size (bp): 9849
• Vector type: Mammalian Expression
• Selectable markers: Gentamicin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: M. alvus PylRS - Acd RS1 (A7)
• Species: Methanomethylophilus alvus
• Insert Size (bp): 834
• Mutation: N166A, V168G, W239C
• Promoter: CMV
• Tag / Fusion Protein:
  • None

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: cgcaaatgggcggtaggcgtg

Gene/Insert 2

• Gene/Insert name: M. alvus Pyl-tRNA (6) (4x copies)
• Species: Methanomethylophilus alvus
• Insert Size (bp): 69
• Promoter: U6/H1

Cloning Information for Gene/Insert 2

• Cloning method: Gateway Cloning
• 5′ sequencing primer: gtagccgaagatgacggtttgtc

Resource Information

• Supplemental Documents:
  • pAcBac Ma Acd A7.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry