pCI-neo-μ1A-(HA)3
(Plasmid #198177)

• Purpose: Expression of HA-tagged AP-1 μ1A in mammalian cells
• Depositing Lab: Juan Bonifacino
• Publication: Guo et al Dev Cell. 2013 Nov 11;27(3):353-66. doi: 10.1016/j.devcel.2013.10.006.

Backbone

• Vector backbone: pCI-neo
• Backbone size w/o insert (bp): 5474
• Total vector size (bp): 6842
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: AP-1 μ1A
• Species: M. musculus (mouse)
• Promoter: CMV
• Tag / Fusion Protein:
  • triple HA tag (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: pCI-neo forward: 5’ CTCTCCACAGGTGTCCACTCCCAGTTC
• 3′ sequencing primer: pCI-neo reverse: 5’ CACTGCATTCTAGTTGTGGTTTGTCCAAACTCATC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

μ1A + linker + HA tag subcloned between EcoRI and SalI sites, double HA tag subcloned between SalI and NotI sites