pCENPTΔC-dCas9-3xGFP
(Plasmid #198325)

• Purpose: Expresses CENPTΔC-dCas9-3xGFP protein in mammalian cells. When coupled with a guide RNA against a high repeat target locus, this can be applied to seed ectopic kinetochores at the target locus
• Depositing Lab: Sarah McClelland
• Publication: Tovini et al EMBO J. 2023 May 15;42(10):e111587. doi: 10.15252/embj.2022111587. Epub 2023 Apr 17.

Backbone

• Vector backbone: pHAGE-TO-dCas9-3XGFP
• Backbone manufacturer: Addgene
• Backbone size w/o insert (bp): 12986
• Total vector size (bp): 14183
• Modifications to backbone: none
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: CENPTΔC
• Species: H. sapiens (human)
• Insert Size (bp): 1125
• Mutation: truncation - encodes only amino acids 1-375
• Entrez Gene: CENPT (a.k.a. C16orf56, CENP-T, SSMGA)
• Promoter: CMV-TetO
• Tags / Fusion Proteins:
  • dCas9 (C terminal on insert)
  • EGFP x 3 (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: ccaatggagtacttcttgtc

Resource Information

• Supplemental Documents:
  • pSMC160 - CENPT-dCas9-3XGFP (G4S linkers).gbk
• A portion of this plasmid was derived from a plasmid made by: Cloned from addgene plasmid 45109
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

CENPTdC was amplified by PCR from Addgene plasmid #45109, using FWD primer: GCCGCCGAATTCGGTGGAGGCGGATCAGGGGGAGGAGGTAGTgagatggcagaccacaac and REV primer: GCCGCCgaattcGCTTCCACCTCCACCTGAACCACCACCGCCttccccttggcttccttc. These primers added 2 X Gly4Ser inter-domain linkers to sit between the CENPTdC and dCas9 domains of the fusion protein, as well as the EcoRI sites for subcloning into the backbone.