pJH4542
(Plasmid #200779)

• Purpose: Ptwk-40s GCaMP6s T2A NLS::mNeptune unc-54 3' UTR C.elegans AVA,AVB and other neurons expression of GCaMP6 and nuclear mNeptune
• Depositing Lab: Mei Zhen
• Publication: Meng et al Sci Adv. 2024 Apr 12;10(15):eadk0002. doi: 10.1126/sciadv.adk0002. Epub 2024 Apr 10.

Backbone

• Vector backbone: pBSK
• Backbone manufacturer: stratagene
• Backbone size w/o insert (bp): 6293
• Total vector size (bp): 7796
• Vector type: Worm Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: GCaMP6
• Species: C. elegans (nematode)
• Insert Size (bp): 1503
• Promoter: Ptwk-40
• Tag / Fusion Protein:
  • mNeptune (C terminal on backbone)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: tggctagcgtcgacggatccaaaaaatgggatctcaccaccaccaccaccacggaa
• 3′ sequencing primer: ttccgtggtggtggtggtggtgagatcccattttttggatccgtcgacgctagcca

Resource Information

• Supplemental Documents:
  • pJH4542

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Industry MTA

Depositor Comments

Please visit for https://www.biorxiv.org/content/10.1101/2021.09.21.461278v4 bioRxiv preprint.

Please note: This plasmid contains a 62 bp deletion in unc-54 3' UTR. This deletion is not known to affect plasmid function.