Skip to main content
Addgene
Open Menu

Mito-TurboID
(Plasmid #200960)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 200960 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 200960-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 200960-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pcDNA3
  • Backbone size w/o insert (bp) 5000
  • Total vector size (bp) 6500
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    mito-TurboID
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1158
  • Promoter CMV
  • Tag / Fusion Protein
    • V5 (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (unknown if destroyed)
  • 3′ cloning site BamHI (unknown if destroyed)
  • 5′ sequencing primer agacccaagcttgggccgccaccatgctggccacccgc
  • 3′ sequencing primer gctgggcctggacagcacctaatgaggatcc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

“Please visit https://www.biorxiv.org/content/10.1101/2023.01.22.525042v2 for bioRxiv preprint.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Mito-TurboID was a gift from Keriann Backus (Addgene plasmid # 200960 ; http://n2t.net/addgene:200960 ; RRID:Addgene_200960)

  • For your References section:

    Proximity-labeling chemoproteomics defines the subcellular cysteinome and inflammation-responsive mitochondrial redoxome. Yan T, Julio AR, Villanueva M, Jones AE, Ball AB, Boatner LM, Turmon AC, Nguyen KB, Yen SL, Desai HS, Divakaruni AS, Backus KM. Cell Chem Biol. 2023 Jul 20;30(7):811-827.e7. doi: 10.1016/j.chembiol.2023.06.008. Epub 2023 Jul 6. 10.1016/j.chembiol.2023.06.008 PubMed 37419112
Related items:
Commonly requested with: