pJM919_WT His POLI
(Plasmid
#201444)
-
PurposeLow copy vector for expressing human DNA polymerase iota in E. coli with an N-terminal 6x His tag
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 201444 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepJM868
- Total vector size (bp) 7631
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameDNA polymerase iota
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2148
-
MutationCoding sequence has been optimised for expression in E. coli
-
Entrez GenePOLI (a.k.a. RAD30B, RAD3OB, eta2)
- Promoter lacIq
-
Tag
/ Fusion Protein
- 6x His (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site Not1 (not destroyed)
- 5′ sequencing primer GCAGCAGCCATCATCATCATC
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJM919_WT His POLI was a gift from Roger Woodgate (Addgene plasmid # 201444 ; http://n2t.net/addgene:201444 ; RRID:Addgene_201444) -
For your References section:
A novel interaction between RAD23A/B and Y-family DNA polymerases. Ashton NW, Jaiswal N, Cestari Moreno N, Semenova IV, D'Orlando DA, Teatin Latancia M, McIntyre J, Woodgate R, Bezsonova I. J Mol Biol. 2023 Nov 5:168353. doi: 10.1016/j.jmb.2023.168353. 10.1016/j.jmb.2023.168353 PubMed 37935254