pet28b-His_RAD23A-UBA2
(Plasmid #201550)

• Purpose: Expresses UBA2 of human RAD23A in E. coli
• Depositing Lab: Roger Woodgate
• Publication: Ashton et al J Mol Biol. 2023 Nov 5:168353. doi: 10.1016/j.jmb.2023.168353.

Backbone

• Vector backbone: pET-28b(+)
• Backbone manufacturer: Novagen
• Total vector size (bp): 5495
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: UV excision repair protein RAD23 homolog A
• Species: H. sapiens (human)
• Mutation: Expresses amino acids 311-363 of DNA polymerase iota. Coding sequence has been optimised for expression in E. coli
• Entrez Gene: RAD23A (a.k.a. HHR23A, HR23A)
• Promoter: T7
• Tag / Fusion Protein:
  • 6x His (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: GCTAGTTATTGCTCAGCGG

Resource Information

• Supplemental Documents:
  • pet28b_His_RAD23A-UBA2.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry