pENTR1a-jAspSnFR3
(Plasmid
#203460)
-
PurposejAspSnFR3 in Gateway cloning entry vector
-
Depositing Lab
-
Depositing OrganizationFred Hutchinson Cancer Center
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 203460 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 203460-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 203460-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepENTR1a
-
Vector typeGateway Cloning
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namejAspSnFR3
-
Insert Size (bp)1564
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CCTGTTAGTTAGTTACTTAAGCTC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2023.06.27.546775 for bioRxiv preprint.
DNA (Catalog # 203460-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 203460-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pENTR1a-jAspSnFR3 was a gift from Lucas Sullivan (Addgene plasmid # 203460 ; http://n2t.net/addgene:203460 ; RRID:Addgene_203460) -
For your References section:
An engineered biosensor enables dynamic aspartate measurements in living cells. Davidsen K, Marvin JS, Aggarwal A, Brown TA, Sullivan LB. eLife. 2024 Feb 23;12:RP90024. doi: 10.7554/eLife.90024. 10.7554/eLife.90024 PubMed 38393319