pRegev_ExonSkip_LandingPad
(Plasmid #204186)

• Purpose: Backbone for cloning individual exon sequences into beta globin minigene splicing reporter.
• Depositing Lab: Oded Regev
• Publication: Liao et al Proc Natl Acad Sci U S A. 2023 Oct 10;120(41):e2221165120. doi: 10.1073/pnas.2221165120. Epub 2023 Oct 5.

Backbone

• Vector backbone: pRegev_ExonSkip_Backbone
• Backbone manufacturer: Regev Group (NYU)
• Total vector size (bp): 8587
• Vector type: Mammalian Expression, Synthetic Biology
• Selectable markers: Zeocin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Beta globin splicing minigene
• Species: Synthetic
• Insert Size (bp): 234
• Promoter: Truncated CAG

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: TAGAAGGCACAGTCGAGG

Resource Information

• Supplemental Documents:
  • pRegev_ExonSkip_LandingPad.gbk
• A portion of this plasmid was derived from a plasmid made by: Minigene design from Kristen Lynch (SA Smith and KW Lynch, "Cell-based splicing of minigenes." (2014)). Backbone design modified from Georg Seelig (AB Rosenberg et al, "Learning the sequence determinants of alternative splicing from millions of random sequences." (2015)).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry