pMZ3012
(Plasmid #204400)

• Purpose: A C4-HSL sensor for B. subtilis on a shuttle vector for B. subtilis and E. coli.
• Depositing Lab: Lauren Andrews
• Publication: Zeng et al ACS Synth Biol. 2023 Dec 11. doi: 10.1021/acssynbio.3c00504.

Backbone

• Vector backbone: pNH4
• Backbone size w/o insert (bp): 6429
• Total vector size (bp): 8186
• Modifications to backbone: This is a shuttle vector containing AmyE homologous arms for integration into B. subtilis genome.
• Vector type: Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: chloramphenicol ( 5 µg/ml) resistant when integrated to B. subtilis genome
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: quorum sensing regulator rhlR
• Insert Size (bp): 720
• Entrez Gene: rhlR (a.k.a. PA3477)
• Promoter: PftsH

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: BbsI (destroyed during cloning)
• 3′ cloning site: BbsI (destroyed during cloning)
• 5′ sequencing primer: NULL
• 3′ sequencing primer: AGATCTTCATCACCGAAACGC

Gene/Insert 2

• Gene/Insert name: GFP
• Insert Size (bp): 717
• Promoter: Synthetic promoter PRhl0L0L12

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: BbsI (destroyed during cloning)
• 3′ cloning site: BbsI (destroyed during cloning)
• 5′ sequencing primer: GACAAATCCGCCGCTCTAG

Resource Information

• Supplemental Documents:
  • pMZ3012.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry