pVITRO1-HAPPID1
(Plasmid #204626)

• Purpose: Expresses the human anti-Phl p 7 IgD/λ antibody 102.1F10 (HAPPID1) in mammalian cells. HAPPID1 binds to the grass pollen allergen Phl p 7 with subnanomolar affinity.
• Depositing Lab: James McDonnell
• Publication: Vester et al Antibodies (Basel). 2023 Nov 16;12(4):75. doi: 10.3390/antib12040075.

Backbone

• Vector backbone: pVITRO1-hygro-mcs
• Backbone manufacturer: InvivoGen
• Backbone size w/o insert (bp): 6441
• Total vector size (bp): 8727
• Vector type: Mammalian Expression
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Hygromycin, 200 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: HAPPID1 heavy chain
• Alt name: human anti-Phl p 7 IgD antibody heavy chain
• Species: H. sapiens (human)
• Insert Size (bp): 1575
• Promoter: mouse elongation factor 1 alpha

Cloning Information for Gene/Insert 1

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: TTTTGAGCGGAGCTAATTCTCGGG
• 3′ sequencing primer: AAAAAACCTCCCACACCTCC

Gene/Insert 2

• Gene/Insert name: HAPPID1 light chain
• Alt name: human anti-Phl p 7 IgD antibody light chain
• Species: H. sapiens (human)
• Insert Size (bp): 711
• Promoter: rat elongation factor 1 alpha

Cloning Information for Gene/Insert 2

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: GAGGCTAATTCTCAAGCCTC
• 3′ sequencing primer: TCTAGACCTGGAAAGACCAG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry