pcDNA5-FRT/TO-mNeonGreen-BRD4
(Plasmid
#204692)
-
PurposeThis plasmid allows for inducible expression of short BRD4 isoform tagged with mNeonGreen, in mammalian cells.
-
Depositing Lab
-
Depositing OrganizationUniversity of Texas Southwestern Medical Center
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 204692 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 204692-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 204692-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepcDNA5
-
Backbone manufacturerThermo Fisher Scientific
- Backbone size w/o insert (bp) 5160
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBRD4
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2916
-
Mutationn/a
-
Entrez GeneBRD4 (a.k.a. CAP, CDLS6, FSHRG4, HUNK1, HUNKI, MCAP)
- Promoter CMV
-
Tag
/ Fusion Protein
- mNeonGreen (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRV (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CCATAGAAGACACCGGGACCGATCC
- 3′ sequencing primer TAGAAGGCACAGTCGAGG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bypurchaced from McDermot Center for Human Growth and Development @ UTSW
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
NLS, mNeonGreen / All our plasmids are pcDNA5-FRT/TO and are used in a co-transfection with Flp recombinase expression vector, pOG44.
DNA (Catalog # 204692-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 204692-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA5-FRT/TO-mNeonGreen-BRD4 was a gift from Michael Rosen (Addgene plasmid # 204692 ; http://n2t.net/addgene:204692 ; RRID:Addgene_204692) -
For your References section:
Molecular features driving condensate formation and gene expression by the BRD4-NUT fusion oncoprotein are overlapping but distinct. Kosno M, Currie SL, Kumar A, Xing C, Rosen MK. Sci Rep. 2023 Jul 24;13(1):11907. doi: 10.1038/s41598-023-39102-9. 10.1038/s41598-023-39102-9 PubMed 37488172