Halo-LC3B HRD
(Plasmid #207539)

• Purpose: Homologous recombination donor to integrate a 3xFLAG-HaloTag at the endogenous LC3B locus in human cells
• Depositing Lab: Jens Schmidt
• Publication: Broadbent et al J Cell Biol. 2023 Jul 3;222(7):e202210078. doi: 10.1083/jcb.202210078. Epub 2023 Apr 28.

Backbone

• Vector backbone: pFastBac dual
• Backbone size w/o insert (bp): 5500
• Total vector size (bp): 9000
• Vector type: Mammalian Expression
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: HaloTag with internal PuroR cassette flanked by human LC3B locus sequences
• Species: H. sapiens (human), Synthetic
• Promoter: Endogenous
• Tag / Fusion Protein:
  • HaloTag (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GCTTTAAAAAACCTCCCACACCTC
• 3′ sequencing primer: AAA CCA CAA CTA GAA TGC AGT GA

Resource Information

• Supplemental Documents:
  • 3xFlag-Halo_puro-LC3.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • HaloTag Vector Limited Use Label License
• Industry Terms:
  • Not Available to Industry