pGL3-NurRE3
(Plasmid #208253)

• Purpose: pGL3 promoter luciferase reporter vector containing 3 copies of the NurRE POMC promoter DNA response element (5′-GATCGTGATATTTACCTCCAAATGCCA- 3′) used for luciferase reporter assays in mammalian cells
• Depositing Lab: Douglas Kojetin
• Publication: Munoz-Tello et al J Med Chem. 2020 Dec 24;63(24):15639-15654. doi: 10.1021/acs.jmedchem.0c00894. Epub 2020 Dec 8.

Backbone

• Vector backbone: pGL3-promoter
• Backbone manufacturer: Promega
• Backbone size w/o insert (bp): 5010
• Total vector size (bp): 5086
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: 3X Nur response element LUC
• Alt name: 3X-NurRE-LUC
• Species: H. sapiens (human)
• Promoter: SV40 early promoter
• Tag / Fusion Protein:
  • No

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (unknown if destroyed)
• 3′ cloning site: XhoI (unknown if destroyed)
• 5′ sequencing primer: CTAGCAAAATAGGCTGTCCC

Resource Information

• Supplemental Documents:
  • pGL3-NurRE3LUC_contig_annot.gbk
• A portion of this plasmid was derived from a plasmid made by: The plasmids were cloned in the Kojetin lab.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry