Skip to main content
Addgene

pFBOH-MHL_CORO1C:1-474
(Plasmid #210920)

Print

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 210920 Standard format: Plasmid sent in bacteria as agar stab 1 $85 *
Add to Cart

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pFBOH-MHL
  • Backbone manufacturer
    pFASTBac1 Modified
  • Vector type
    Insect Expression
  • Selectable markers
    Gentamicin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CORO1C:M1-A474
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1422
  • Mutation
    wild type
  • Entrez Gene
    CORO1C (a.k.a. HCRNN4)
  • Promoter Polyhedrin
  • Tag / Fusion Protein
    • MHHHHHHSSGRENLYFQG (N terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer tattccggattattcataccg
  • 3′ sequencing primer ctctacaaatgtggtatggc
    • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Mammalian Gene Collection (BC002342)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

5' Cloning Site: BseRI (destroyed), 3' Cloning Site: BseRI (destroyed).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFBOH-MHL_CORO1C:1-474 was a gift from Cheryl Arrowsmith (Addgene plasmid # 210920 ; http://n2t.net/addgene:210920 ; RRID:Addgene_210920)

  • For your References section:

    A Target Class Ligandability Evaluation of WD40 Repeat-Containing Proteins. Ackloo S, Li F, Szewczyk M, Seitova A, Loppnau P, Zeng H, Xu J, Ahmad S, Arnautova YA, Baghaie AJ, Beldar S, Bolotokova A, Centrella PA, Chau I, Clark MA, Cuozzo JW, Dehghani-Tafti S, Disch JS, Dong A, Dumas A, Feng JA, Ghiabi P, Gibson E, Gilmer J, Goldman B, Green SR, Guie MA, Guilinger JP, Harms N, Herasymenko O, Houliston S, Hutchinson A, Kearnes S, Keefe AD, Kimani SW, Kramer T, Kutera M, Kwak HA, Lento C, Li Y, Liu J, Loup J, Machado RAC, Mulhern CJ, Perveen S, Righetto GL, Riley P, Shrestha S, Sigel EA, Silva M, Sintchak MD, Slakman BL, Taylor RD, Thompson J, Torng W, Underkoffler C, von Rechenberg M, Walsh RT, Watson I, Wilson DJ, Wolf E, Yadav M, Yazdi AK, Zhang J, Zhang Y, Santhakumar V, Edwards AM, Barsyte-Lovejoy D, Schapira M, Brown PJ, Halabelian L, Arrowsmith CH. J Med Chem. 2025 Jan 23;68(2):1092-1112. doi: 10.1021/acs.jmedchem.4c02010. Epub 2024 Nov 4. 10.1021/acs.jmedchem.4c02010 PubMed 39495097
Related items:
Commonly requested with: