Skip to main content
Addgene
Open Menu

pAC150-KEIMA-VAPA
(Plasmid #212096)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 212096 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 212096-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 212096-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pAC150-PBLHL-4xHS-EF1a-DEST
  • Backbone manufacturer
    Addgene Plasmid #48234
  • Vector type
    Mammalian Expression ; PiggyBac
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    VAPA
  • Alt name
    VAMP-A
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    883
  • GenBank ID
    NM_003574.6
  • Entrez Gene
    VAPA (a.k.a. VAMP-A, VAP-33, VAP-A, VAP33, hVAP-33)
  • Promoter EF1a
  • Tag / Fusion Protein
    • mKeima (N terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAC150-KEIMA-VAPA was a gift from Wade Harper (Addgene plasmid # 212096 ; http://n2t.net/addgene:212096 ; RRID:Addgene_212096)

  • For your References section:

    Combinatorial selective ER-phagy remodels the ER during neurogenesis. Hoyer MJ, Capitanio C, Smith IR, Paoli JC, Bieber A, Jiang Y, Paulo JA, Gonzalez-Lozano MA, Baumeister W, Wilfling F, Schulman BA, Harper JW. Nat Cell Biol. 2024 Mar;26(3):378-392. doi: 10.1038/s41556-024-01356-4. Epub 2024 Mar 1. 10.1038/s41556-024-01356-4 PubMed 38429475
Related items:
Commonly requested with: