Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pUAS-Luc
(Plasmid #21604)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 21604 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pBluescript SK(-)
  • Backbone manufacturer
    Stratagene
  • Backbone size w/o insert (bp) 3415
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Gentamycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    UAS-hsp70 luciferase
  • Insert Size (bp)
    1977

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer TCCCAGTCACGACGTTGTAAAACGACGGCC
  • 3′ sequencing primer CACACAGGAAACAGCTATGACCATGATTAC
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUAS-Luc was a gift from Takahiro Kusakabe (Addgene plasmid # 21604 ; http://n2t.net/addgene:21604 ; RRID:Addgene_21604)
  • For your References section:

    Analysis of protein interactions with two-hybrid system in cultured insect cells. Mon H, Sugahara R, Hong SM, Lee JM, Kamachi Y, Kawaguchi Y, Kusakabe T. Anal Biochem. 2009 May 26. ():. 10.1016/j.ab.2009.05.033 PubMed 19481053