pIE2-DBD
(Plasmid
#21602)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 21602 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepIZT
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 4628
-
Vector typeInsect Expression ; Gateway Destination Vector
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Tetracycline, 25 & 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Growth instructionsDB3.1
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGAL4 DBD
-
Alt nameGAL4 DNA binding domain
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)591
-
GenBank IDNP_015076
-
Entrez GeneGAL4 (a.k.a. YPL248C, GAL81)
-
Tags
/ Fusion Proteins
- 3xHA (N terminal on backbone)
- Gateway destination cassette (C terminal on backbone)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer TTATCGCGCCTATAAATACAGCCCGCAAC
- 3′ sequencing primer CACGCGCTTGAAAGGAGTGTGTAAATGGAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pIE2-DBD was a gift from Takahiro Kusakabe (Addgene plasmid # 21602 ; http://n2t.net/addgene:21602 ; RRID:Addgene_21602) -
For your References section:
Analysis of protein interactions with two-hybrid system in cultured insect cells. Mon H, Sugahara R, Hong SM, Lee JM, Kamachi Y, Kawaguchi Y, Kusakabe T. Anal Biochem. 2009 May 26. ():. 10.1016/j.ab.2009.05.033 PubMed 19481053