p133Tol2-Olactb:MCS, hsp70l-mcherry-CreERT2
(Plasmid
#227775)
-
PurposeExpression of beta actin driven BFP with multiple cloning site at 3' end. Also contains heat-shock activated mCherry reporter and CreERT2.
-
Depositing Lab
-
Depositing OrganizationUniversity of Pennsylvania
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 227775 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 227775-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 227775-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneTol2
- Total vector size (bp) 15690
-
Vector typezebrafish expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameBFP-MCS
-
Insert Size (bp)756
- Promoter Olactb
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer CTGACAGGAAATGGGACATCTGAC
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namemCherry-t2A-CreERT2
-
Insert Size (bp)3016
- Promoter hsp70l
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer TTCCCCGACGAGGTGTTTATTCG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 227775-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 227775-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p133Tol2-Olactb:MCS, hsp70l-mcherry-CreERT2 was a gift from Bushra Raj (Addgene plasmid # 227775 ; http://n2t.net/addgene:227775 ; RRID:Addgene_227775) -
For your References section:
Barcoding Notch signaling in the developing brain. Siniscalco AM, Perera RP, Greenslade JE, Veeravenkatasubramanian H, Masters A, Doll HM, Raj B. Development. 2024 Nov 22:dev.203102. doi: 10.1242/dev.203102. 10.1242/dev.203102 PubMed 39575683
Map uploaded by the depositor.
