pEdit
(Plasmid
#232355)
-
PurposeThe pEdit series plasmids are derived from the pTarget series plasmids by inserting homologous recombination arms targeting the gene of interest, which enables gene knockout or gene insertion at the t
-
Depositing Lab
-
Depositing OrganizationJiangnan University
Located in China -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 232355 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 232355-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 232355-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepMB1
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA
-
gRNA/shRNA sequencettgacagctagctcagtcctaggtataatactagtacgctgaaagaaacgccgcagttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgctttttt
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 232355-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 232355-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEdit was a gift from Yujie Cai (Addgene plasmid # 232355 ; http://n2t.net/addgene:232355 ; RRID:Addgene_232355) -
For your References section:
Construction of a CRISPR-Cas9-Based Genetic Editing Tool for Serratia marcescens Using a Stationary Phase Promoter and Its Application in Putrescine Production. Gou L, Liu D, Fan TP, Deng H, Cai Y. Biotechnol Bioeng. 2025 May;122(5):1233-1244. doi: 10.1002/bit.28949. Epub 2025 Feb 5. 10.1002/bit.28949 PubMed 39910976
