Skip to main content
Addgene
Open Menu

pN1-PinkyCaMP
(Plasmid #232861)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 232861 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 232861-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 232861-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pN1
  • Backbone size w/o insert (bp) 3961
  • Total vector size (bp) 5386
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PinkyCaMP
  • Species
    Synthetic
  • Insert Size (bp)
    1425
  • Promoter CMV

Cloning Information

  • Cloning method Other
  • 5′ sequencing primer GAGGTCTATATAAGCAGAGC
  • 3′ sequencing primer AACCATTATAAGCTGCAATAAAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2024.12.16.628673 for bioRxiv preprint.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pN1-PinkyCaMP was a gift from Olivia Masseck (Addgene plasmid # 232861 ; http://n2t.net/addgene:232861 ; RRID:Addgene_232861)

  • For your References section:

    PinkyCaMP: an mScarlet-based calcium sensor with enhanced brightness, photostability and multiplexing capabilities. Fink R, Imai S, Gockel N, Lauer G, Renken K, Wietek J, Lamothe-Molina PJ, Fuhrmann F, Mittag M, Ziebarth T, Canziani A, Kubitschke M, Kistmacher V, Kretschmer A, Sebastian E, Ottens J, Schmitz D, Terai T, Grundemann J, Hassan SI, Patriarchi T, Reiner A, Fuhrmann M, Campbell RE, Masseck OA. Nat Methods. 2026 Apr 24. doi: 10.1038/s41592-026-03065-2. 10.1038/s41592-026-03065-2 PubMed 42032066
Related items:
Commonly requested with: