Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

CMV-Mito4x-GCaMP6f
(Plasmid #127870)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 127870 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pcDNA3
  • Backbone size w/o insert (bp) 5433
  • Total vector size (bp) 7197
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    4 repeats of COX8 signal peptide plus GCaMP6f
  • Species
    Synthetic
  • Insert Size (bp)
    1764
  • Promoter CMV

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer TAGAAGGCACAGTCGAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CMV-Mito4x-GCaMP6f was a gift from Timothy Ryan (Addgene plasmid # 127870 ; http://n2t.net/addgene:127870 ; RRID:Addgene_127870)
  • For your References section:

    Molecular Tuning of the Axonal Mitochondrial Ca(2+) Uniporter Ensures Metabolic Flexibility of Neurotransmission. Ashrafi G, de Juan-Sanz J, Farrell RJ, Ryan TA. Neuron. 2019 Dec 10. pii: S0896-6273(19)30984-5. doi: 10.1016/j.neuron.2019.11.020. 10.1016/j.neuron.2019.11.020 PubMed 31862210