Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
As of April 1, 2023, we increased some of our prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

ER-GCaMP6-150
(Plasmid #86918)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 86918 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    FCK(1.3)GW
  • Backbone size w/o insert (bp) 9246
  • Total vector size (bp) 10698
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Zeo marker is outside the LTRs and will not be packaged into virus.

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ER-GCaMP6-150
  • Species
    Synthetic
  • Insert Size (bp)
    1452
  • Mutation
    K78H, T302L, R303P, A317E, D324G, D360G, D380Y, T381R, S383T, R392G in GCaMP3
  • Promoter CAMKII

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer atgactgagaccctcccacccgtg actgaaagcgccgt
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    ER-GCaMP6-150 was a gift from Timothy Ryan (Addgene plasmid # 86918 ; http://n2t.net/addgene:86918 ; RRID:Addgene_86918)
  • For your References section:

    Axonal Endoplasmic Reticulum Ca2+ Content Controls Release Probability in CNS Nerve Terminals. de Juan-Sanz J, Holt GT, Schreiter ER, de Juan F, Kim DS, Ryan TA. Neuron. 2017 Jan 30. pii: S0896-6273(17)30034-X. doi: 10.1016/j.neuron.2017.01.010. 10.1016/j.neuron.2017.01.010 PubMed 28162809