pDisplay-GRAB-rACh1h-IRES-EGFP-CAAX
(Plasmid
#234416)
-
PurposeExpresses the red ACh sensor GRAB rACh1h and a membrane-localized EGFP in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 234416 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepDisplay
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGRAB-rACh1h
-
SpeciesSynthetic
-
Insert Size (bp)1932
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATGGAGACAGACACACTCCTGC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.12.22.627112 for the bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDisplay-GRAB-rACh1h-IRES-EGFP-CAAX was a gift from Yulong Li (Addgene plasmid # 234416 ; http://n2t.net/addgene:234416 ; RRID:Addgene_234416) -
For your References section:
Red-shifted GRAB acetylcholine sensors for multiplex imaging in vivo. Xie S, Miao X, Li G, Zheng Y, Li M, Ji E, Wang J, Li S, Cai R, Geng L, Feng J, Wei C, Li Y. Nat Neurosci. 2026 Jun 16. doi: 10.1038/s41593-026-02325-w. 10.1038/s41593-026-02325-w PubMed 42303796