pAAV-CAG2-GCaMP6s
(Plasmid
#241022)
-
PurposeAn AAV transfer plasmid expressing the GCaMP6s genetically encoded calcium indicator under control of the ubiquitously expressed CAG2 promoter.
-
Depositing Lab
-
Depositing OrganizationJohns Hopkins University and School of Medicine
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 241022 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $34 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backboneAAV-CAG2-EGFP-T2A-WGA-iCre (VB1369)
-
Backbone manufacturerVector Biolabs
- Backbone size w/o insert (bp) 4761
- Total vector size (bp) 6113
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGCaMP6s
-
SpeciesSynthetic
-
Insert Size (bp)1353
- Promoter CAG2
-
Tag
/ Fusion Protein
- 6X His tag (N terminal on insert)
Cloning Information
- Cloning method Gene Synthesis
- 5′ sequencing primer CGTTACTCCCACAGGTGAGC; TTTCTGTGGCTGCGTGAAAG; GCGCTTGGTTTAATGACGGC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-CAG2-GCaMP6s was a gift from Thomas Johnson (Addgene plasmid # 241022 ; http://n2t.net/addgene:241022 ; RRID:Addgene_241022) -
For your References section:
The internal limiting basement membrane inhibits functional engraftment of transplanted human retinal ganglion cells in vivo. Aguzzi EA, Mary S, Vardanjani MM, Godinez DR, Kimball E, Bonakdar B, Zhang KY, Du J, Nagalingam A, Yutzy W, Quillen S, Hariharakumar S, Quigley HA, Zack DJ, Handa JT, Johnson TV. Sci Transl Med. 2026 Apr 29;18(847):eadr1062. doi: 10.1126/scitranslmed.adr1062. Epub 2026 Apr 29. 10.1126/scitranslmed.adr1062 PubMed 42054496