Skip to main content

pAAV-CAG2-GCaMP6s
(Plasmid #241022)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 241022 Standard format: Plasmid sent in bacteria as agar stab 1 $94

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    AAV-CAG2-EGFP-T2A-WGA-iCre (VB1369)
  • Backbone manufacturer
    Vector Biolabs
  • Backbone size w/o insert (bp) 4761
  • Total vector size (bp) 6113
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GCaMP6s
  • Species
    Synthetic
  • Insert Size (bp)
    1353
  • Promoter CAG2
  • Tag / Fusion Protein
    • 6X His tag (N terminal on insert)

Cloning Information

  • Cloning method Gene Synthesis
  • 5′ sequencing primer CGTTACTCCCACAGGTGAGC; TTTCTGTGGCTGCGTGAAAG; GCGCTTGGTTTAATGACGGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-CAG2-GCaMP6s was a gift from Thomas Johnson (Addgene plasmid # 241022 ; http://n2t.net/addgene:241022 ; RRID:Addgene_241022)
  • For your References section:

    The internal limiting basement membrane inhibits functional engraftment of transplanted human retinal ganglion cells in vivo. Aguzzi EA, Mary S, Vardanjani MM, Godinez DR, Kimball E, Bonakdar B, Zhang KY, Du J, Nagalingam A, Yutzy W, Quillen S, Hariharakumar S, Quigley HA, Zack DJ, Handa JT, Johnson TV. Sci Transl Med. 2026 Apr 29;18(847):eadr1062. doi: 10.1126/scitranslmed.adr1062. Epub 2026 Apr 29. 10.1126/scitranslmed.adr1062 PubMed 42054496