AAVS1-CAG-GCaMP6s
(Plasmid #241023)

• Purpose: An HDR plasmid for the AAVS1 safe harbor locus carrying a gene cassette consisting of GCaMP6s under control of a CAG promoter and a WPRE.
• Depositing Lab: Thomas Johnson
• Publication: Aguzzi et al Sci Transl Med. 2026 Apr 29;18(847):eadr1062. doi: 10.1126/scitranslmed.adr1062. Epub 2026 Apr 29.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $34 USD for plasmid.
• How this works:
  • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: AAVS1-CAG-hrGFP
• Backbone manufacturer: Addgene #52344
• Backbone size w/o insert (bp): 7802
• Total vector size (bp): 9756
• Vector type: CRISPR
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: GCaMP6s and WPRE
• Species: Synthetic
• Insert Size (bp): 1952
• Promoter: CAG
• Tag / Fusion Protein:
  • 6x His Tag (N terminal on insert)

Cloning Information

• Cloning method: Gene Synthesis
• 5′ sequencing primer: AATCTGTGCGGAGCCGAAAT; AAATCTGTGCGGAGCCGAAA; TTGTCCCAAATCTGTGCGGAG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry