Skip to main content
Addgene
Open Menu

CMV::SypHy A4
(Plasmid #24478)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 24478 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 24478-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 24478-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pEGFP-C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 3952
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SypHy
  • Alt name
    Rat Synaptophysin-pHluorin
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    1665
  • Entrez Gene
    Syp (a.k.a. Syp1)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Xho1 (not destroyed)
  • 3′ cloning site Not1 (destroyed during cloning)
  • 5′ sequencing primer cctctacaaatgtggtatggc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The depositing lab notes that the Xba1 and Bcl1 unique restriction digestion sites could be methylated and blocked if the plasmid is grown or maintained in dam+ bacteria.

Also note that in the Addgene-generated map below, the feature listed as "GFP(12-708)" is actually pH sensitive pHluorin.

There is a mutation S446T in Synaptophysin ORF. This change does not have any effect in localizing the construct to the synaptic vesicle and may be a result of a SNP.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CMV::SypHy A4 was a gift from Leon Lagnado (Addgene plasmid # 24478 ; http://n2t.net/addgene:24478 ; RRID:Addgene_24478)

  • For your References section:

    Clathrin-mediated endocytosis is the dominant mechanism of vesicle retrieval at hippocampal synapses. Granseth B, Odermatt B, Royle SJ, Lagnado L. Neuron. 2006 Sep 21. 51(6):773-86. 10.1016/j.neuron.2006.08.029 PubMed 16982422
Related items:
Commonly requested with: